Houses for sale in rincon pr.
30 homes for sale in Calvache, PR. View photos and listing details of Calvache, PR real estate, save or compare the properties you like. Skip to main content. More Less. ... (STELLA) RINCON, Stella, PR 00677 13,993 Sqft Sqft; 0.321 ac Lot Size; Real Estate Experts in Calvache, PR. 1; 1 - 30 of 30 Results. United States; Puerto Rico Rincon ...
Find your dream multi family home for sale in Rincon, Rincon County, PR at realtor.com®. We found 4 active listings for multi family homes. See photos and more.30 homes for sale in Atalaya, PR. View photos and listing details of Atalaya, PR real estate, save or compare the properties you like.Road, Rincon, PR 00677 is for sale. View 12 photos of this 8 acre lot land with a list price of $2900000. Explore the homes with Waterfront that are currently for sale in Rincon, Rincon County, PR, where the average value of homes with Waterfront is $445,000. Visit realtor.com® and browse house ...
Browse Rincon County, PR real estate. Find 24 homes for sale in Rincon County with a median listing home price of $449,000.
Find your dream home in Rincon, Cayey Municipality, PR! Browse through a variety of homes for sale in Rincon, Cayey Municipality, PR and choose the perfect one for you.Are you on the hunt for an affordable home? If you’re looking to buy a house without breaking the bank, it’s important to know where and how to find the cheapest houses for sale in...
Search 00677 real estate property listings to find homes for sale in Rincon, PR. Browse houses for sale in 00677 today!Explore the homes with Newest Listings that are currently for sale in Rincon, Rincon County, PR, where the average value of homes with Newest Listings is $515,000. Visit realtor.com® and browse ...Condominio Millenium, 550 Av. de la Constitución, San Juan, 00901, San Juan, PR 00901Road, Rincon, PR 00677 is for sale. View 12 photos of this 8 acre lot land with a list price of $2900000.
1 Rincon Ocean Clb #302, Rincon, PR 00677 is currently not for sale. The -- sqft home type unknown home is a -- beds, -- baths property. This home was built in null and last sold on 2024-04-03 for $--. View more property details, sales history, and Zestimate data on Zillow.
Description for Beachfront Condo at Rincon Ocean Club. E:6321. Spacious beachfront apartment located on the third level of the Rincon Ocean Club Condominium. It has beautiful views of the sea, Desecheo and sunsets from the privacy of it. It consists of two bedrooms, two bathrooms, living room, full kitchen, dining room and balcony facing the sea.
3 bed. 2,041 sqft. 2,041 sqft lot. Km 4 1 Carr 413 St # A1. Rincon, PR 00677. Additional Information About B 27 Porto Vecchio St, Rincon, PR 00677. See B 27 Porto Vecchio St, Rincon, PR 00677, a ...Maria and her son Ramon lived on the beach for over 50 years, becoming beloved residents of the town of Rincon, Puerto Rico. Maria was a surrogate host of the 1968 World Surfing Championships that took place on Maria's Beach. ... The house was in a perfect location, was beautifully decorated, and included everything we needed to accommodate ...Finding homes for sale in Rincon, Rincon Municipality, PR has never been easier as our comprehensive directory currently contains more than 30 listings! With prices for houses for sale in Rincon, Rincon Municipality, PR starting as low as $330,000, we make the search for the perfect home easy by providing you with the right tools!Find 60 Rincon Real Estate For Sale In PR. See house photos, 3D tours, listing details & neighborhood list of Rincon real estate for sale.Cheap homes for sale in Rincon, Rincon Municipality, PR. Find the latest property listings around Rincon, Rincon Municipality, PR, with easy filtering options. Find your next affordable home or property here.Find your dream home in Aguada Municipality, PR! Browse through a variety of homes for sale in Aguada Municipality, PR and choose the perfect one for you. Get in touch with us today!Looking for North Puerto Rico, PR Single-Family Homes? Browse through 166 Homes for sale in North Puerto Rico, PR with prices between $40,000 and $8,440,000
Bo Puntas Rincon, Rincon, PR 00677 is a land for sale listed on the market for 348 Days. Bo Puntas Rincon, Rincon, PR 00677 is pending. View 7 photos of this 3.28 acre lot land with a list price ...View 112 homes for sale in Brisas Del Mar, PR at a median listing home price of $249,900. See pricing and listing details of Brisas Del Mar real estate for sale.Sitting on 45 acres, the estate’s expansive grounds feature a private helipad, horse stables, guest houses, a wine cellar, and lookout towers. The estate encapsulates over 10,000 square feet of living space.View 1768 single family homes for sale in Puerto Rico. Check PR real estate inventory, browse property photos, and get listing information at realtor.com®.1056 single family homes for sale in Puerto Rico. View pictures of homes, review sales history, and use our detailed filters to find the perfect place. Skip main navigation. Sign In. Join; ... Rincon, PR 00677. ISLAND WEST PROPERTIES. $249,000. 2 bds; 3 ba; 1,000 sqft - House for sale. Show more. Price cut: $150,000 (Feb 19)House For Sale for $544,000 USD. 6 beds, 4 baths, 3,625 sqft at Carr 413 km 0.2 in Rincon, PR, 00677. $544,000 USD: Great opportunity to remake this two units of all concrete construction on 510 sq meters . Main house has 4 bedrooms, 2.5 baths on 2 levels with a nice office area and large terrace. Second uni...
Ocean Drive ST. REGIS BAHIA BEACH RESORT 1102, Rio Grande, PR 00745. Luxury Homes for Sale in Puerto Rico, priced over $1,000,000. Experience the ultimate in luxury living with our exquisite collection of high-end homes for sale in Puerto Rico.
Looking for homes for Sale in Rincon, Puerto Rico? Weichert has you covered with Rincon homes for Sale & more! Skip page header and navigation. 1-800-401-0486.937 cheap homes for sale in Puerto Rico, PR, priced up to $320,000. Find the latest property listings around Puerto Rico, with easy filtering options. Find your next affordable home or property hereFinca PR 115 KM 15.3, SECTOR JULIO GUERRA, BO. RIO GRANDE, Rincon Rincon, PR 00677Apr 26, 2024 · Rincón, Puerto Rico Real Estate Services. We offer a full range of services related to property listings and sales, as well as buyer’s agents. With an experienced and very knowledgeable team of bilingual agents, Rincon Real Estate Puerto Rico is proud to serve Rincon and the West Coast of Puerto Rico since 2008 as well as providing helpful ... Find your dream home in Rincon Grande, Arecibo Municipality, PR! Browse through a variety of homes for sale in Rincon Grande, Arecibo Municipality, PR and choose the perfect one for you. Get in touch with us today!Island West Properties is one of the longest established real estate. brokerages in Western Puerto Rico, operating continuously since 1993, with an. experienced and very knowledgeable team of ...solar llano 1,300 metros, a pasos playa, estella (stella) rincon, stella, pr 00677148,068 sqft. 3.4 acre lot. 1 Hacienda La Charca Bo Cruces. Rincon, PR 00677. Additional Information About Atalaya Lot 6, Rincon, PR 00677. See Atalaya Lot 6, Rincon, PR 00677, a plot of land ...
Search 9 new construction homes for sale in Rincon, Rincon County, PR. See photos and plans from new home builders at realtor.com®.
Selling a house can be an overwhelming process, especially when you want to get the highest possible sale price. Fortunately, there are several strategies you can employ to maximiz...
148,068 sqft. 3.4 acre lot. 1 Hacienda La Charca Bo Cruces. Rincon, PR 00677. Additional Information About Atalaya Lot 6, Rincon, PR 00677. See Atalaya Lot 6, Rincon, PR 00677, a plot of land ...110 Homes For Sale in Rincon County, PR. Browse photos, see new properties, get open house info, and research neighborhoods on Trulia. Page 3Get in Touch. Ready to take the next step in your real estate journey? Contact us today to schedule a consultation with one of our experts. We're here to answer your questions and help you get started on the path to success. (787) 316-1077 * (939) 334-9274. [email protected]. [email protected] Rincon Ocean Clb #302, Rincon, PR 00677 is currently not for sale. The -- sqft home type unknown home is a -- beds, -- baths property. This home was built in null and last sold on 2024-04-03 for $--. View more property details, sales history, and Zestimate data on Zillow.111 Homes For Sale in Stella, PR 00677. Browse photos, see new properties, get open house info, and research neighborhoods on Trulia.Rincon Homes for Sale Rincon Homes for Sale Rincon Homes for Sale Isabela Homes for Sale Culebra Homes for Sale Cabo Rojo Homes for Sale ... Real Estate Experts in Puerto Rico. See all agents in Puerto Rico Choose language: English Español? Pick your country: United States; Canada; Other Country; Keep Connected. About Us;35 Single Family Homes For Sale in Rincon, PR. Browse photos, see new properties, get open house info, and research neighborhoods on Trulia.Carr 115 Rincon, Rincon, PR 00677 is currently not for sale. The -- sqft home type unknown home is a -- beds, -- baths property. This home was built in null and last sold on 2023-10-30 for $--. View more property details, sales …
View 88 homes for sale in Mayaguez, PR at a median listing home price of $120,000. See pricing and listing details of Mayaguez real estate for sale.Rincon homes for sale. Homes for sale; Foreclosures; For sale by owner; Open houses; New construction; Coming soon; Recent home sales; All homes; Resources. ... Rincon PR Recently Sold Homes. 38 results. Sort: Homes for You. Carr Las Pinas Sector La Joya, Rincon, PR 00677. ISLAND WEST PROPERTIES. $300,000. 0.49 …Barrero. Finding homes for sale in Barrero, Rincon Municipality, PR has never been easier as our comprehensive directory currently contains more than 30 listings! With prices for houses for sale in Barrero, Rincon Municipality, PR starting as low as $469,000, we make the search for the perfect home easy by providing you with the right tools!Road # 115, Rincon, PR 00677 is for sale. View 4 photos of this 9.83 acre lot land with a list price of $1000000.Instagram:https://instagram. rikas peruvian cuisine menuflorida gun show 2024what is wrong with the following piece of mrna taccaggatcactttgccaaimsweb reading fluency norms Explore the homes with Big Lot that are currently for sale in Rincon, PR, where the average value of homes with Big Lot is $445,000. Visit realtor.com® and browse house photos, view details ... lamoille court calendaramc theater sun prairie wi Isabela Municipality, PR Homes for Sale & Real Estate. 103 Homes for Sale in Isabela Municipality, PR Sort results by. Sort by Best match Best match Price (low to high) Price (high to low) Newest Bedrooms ... who pays more doordash or ubereats 1 Rincon Ocean Clb #302, Rincon, PR 00677 is currently not for sale. The -- sqft home type unknown home is a -- beds, -- baths property. This home was built in null and last sold on 2024-04-03 for $--. View more property details, sales history, and Zestimate data on Zillow.If you’re on the market for a new home, there’s plenty of resources available to help you find the right fit. From consulting with a realtor to conducting your own search, here are...Zillow has 1 single family rental listings in Rincon PR. Use our detailed filters to find the perfect place, then get in touch with the landlord. ... Homepage. Buy Open Buy sub-menu. Rincon homes for sale. Homes for sale; Foreclosures; For sale by owner; Open houses; New construction; Coming soon; ... Rincon PR Houses For Rent. 1 results. Sort ...